Google vytvoří Jurský park

27. listopadu 2005 v 14:20 | Petr Šnajdr |  Technologie a věda
Na lecjaká překvapení od Google jsme si již zvykli, ale stejně jako by nikdo netipoval jeho spolupráci s NASA na vesmírném programu, málokdo by řekl, že se pustí do genetického inženýrství. V tuto chvíli má však již k dispozici desetitisíce zmapovaných genů od Craiga Ventura a další z National Institute of Health.

Podle Google může jeho technologie napomoci lepšímu porozumění geonomu (tedy souhrnu genetických informací) a tak vést k vývoji zcela nových přístupů v medicíně. Zní to jako sci-fi, ale není to zcela nemožné. Současné léky jsou sice řádně otestovány, ale každý organismus je jiný a i prostředí může na jejich účinnost mít zásadní vliv. Nemluvě o kontraindikacích.
A tak lék, který obdržíte v lékárně může fungovat pro 99,9% populace, ale ne u vás. A nebo, a to je ještě mnohem horší, může u vás vyvolávat nežádoucí reakce, které vám ho mohou zcela zabránit používat. S rostoucím znečištěním prostředí, "průmyslovým stylem" života atd. roste i naše přecitlivělost a již nyní existuje dost lidí, kteří jsou přecitlivělí na antibiotika atd.

Kromě nekompatibility je tu další problém a to, že mnoho léků má v podstatě poměrně invazní charakter. Jejich cílem je "vymlátit" z vašeho těla co se dá. Samozřejmě primárně bakterie, které jsou zdrojem vaší choroby, ale obdobně si to může odskákat střevní mikroflóra a tak dále.

Je možné, že stejně jako existuje několik krevních skupin a podskupin, i tak existuje nějaká relativně malá skupina sobě si blízkých genofondů a nikdy a výroba léků přesně na míru vašeho těla nebude potřebná. Ale i to je třeba zjistit a popsat.

Genetické inženýrství

Genetická informace kódovaná v DNA (případně RNA) je zřejmě nejstarším programovacím jazykem planety. Pokud si vzpomínáte ještě na hodiny biologie, tak DNA, tedy Deoxyribonukleobá kyselina je obrovská makromolekula složená z fosfátů, deoxyribózy a nukleových bází.
Fosfáty jsou jakousi maltou, která udržuje makromolekulu pohromadě spolu s molekulami deoxyribózy. Na deoxyribózu se pak vážou nukleotidy. Takto jsou vytvořena dvě vlákna, která jsou spojena do známé šroubobovice pomocí vodíkových můstků mezi jednotlivými bázemi.

Vlastní informace je vyjádřena kombinacemi bázi, které se dělí do dvou skupin, která má každá po dvou typech:

Skupina purinových bází: Adenin a Guanin
Skupina pyrimidinových bází: Thymin a Cytosin

Proto aby jste s nimi byli schopni programovat, musíte ctít sémantiku jazyka jejíž nejdůležitějším pravidlem je komplementarita bází. Prakticky to znamená, že cytosin se vždy váže s guaninem a adenin s thyminem.

Na první pohled vidíte, že příroda zvolila trochu složitější koncept než je jen plochá binární struktura v naších počítačích a můžete ji zjednodušeně pojmout jako 4bitovou. Způsob kódování, ale může být rozdílný. Kódovací schéma, dali se k tomu tak vůbec přistupovat, neznám. Ale uvědomte si, že se stejným problém by jste se setkali i kdyby jste měli rozkódovat strojový kód neznámého procesoru viz. konvence big endian a nebo little endian. A to jsme teprve na začátku. Dále je třeba naprosto přesně rozklíčovat geny, chromozomy a teprve pak celý genofond.

Tablety proti AIDS by Google

Mnoho chorob je způsobeno viry. Virus jako takový je prakticky téměř čistá informace zabudovaná do DNA nebo RNA, která je schopná překódovat buňky organismu tak, aby přestaly plnit svoji úlohu a namísto toho začali plodit virus.

Kromě vlastní genetické informace ještě může obsahovat obal z peptidu a nebo u složitějších několik membrán z původní buňky. Sám o sobě není schopen reprodukce.

V posledních desetiletích je často zmiňován virus způsobující AIDS. Jedná se o retrovirus, který disponuje pouze ribonukleotidy, ale je schopen na základě přepisu z RNA do DNA vytvářet DNA nukleotidy. Jeho genetická informace je rozdělena do 3 genů a to tat, rev a nef.

Geny tat a rev obsahuji program pro řízení postupných kroků vývoje viru v buňce. Třetí, který se nachází na konci molekuly RNA, naopak rozvoj viru brzdí.

Virus je programován tak, aby nevedl k AIDS, viz. gen nef. Pokud byl vytvořen uměle, jak se občas tvrdívávalo, pak jeho programátor je pořádný packal. Přepis z RNA do DNA je totiž velice primitivní s poměrně vysokou chybovostí - jinými slovy genetickou nestabilitou. Ta postupně vede k poškození genu nef a tím je virus "odbržděn" a začne se nekontrolovaně šířit organismem. Poškození tat a rev genů není fatální, tedy je naprosto fatální, ale tyto poškození povedou pravděpodobně ke zničení takto vzniklé mutace a tak na celkový výsledek to nemá vliv.

Nabízí se dvě cesty jak se vůči viru postavit. Obě jsou dost šílené.

První vychází z toho, že již nyní jsou známí lidé, kteří jsou vůči viru HIV odolní a to díky některé charakteristice jejich genofondu. U nich možná leží klíč proti boji s HIV.

Druhá cesta je virus přeprogramovat. Provést jeho reengenering a stabilizovat ho, následně pak modifikovat jeho geny tat a rev tak, aby se nebyl schopen dál šířit.

Lék by nicméně asi nevypadal jako tableta s nápisem Google. I když kdo ví.
Horší zpráva je, že pro takového hrádky je třeba dost velkého technologického pokroku. Avšak proto, abyste mohli něco řídit, musíte to nejdříve zmapovat - poznat. Technologie Google tomu může pomoci, ale je to jen začátek pro něco mnohem a mnohem složitějšího.

Genetické šílenství

Co tak na chvíli ale opravdu popustit uzdu fantazii? Slabši a zejména paranoidní povahy by nyní měly přestat číst. Moc bych se nedivil kdyby tento prostor se pokusil někdo někdy využít k ukládání dat. Například mé jméno zapsané v DNA zní takto:
        TATAATATTACGTATATAGCTAATTAGCAT 
        CGATCGATATCGATCGCGTACGGCCGTAC 
        GATTATACGCGCGTACGTAATTAGCATCG 
A adresa Google tj.
Google Inc.
1600 Amphitheatre Parkway
Mountain View CA 94043
phone: (650) 253-0000
fax: (650) 253-0001
... by vypadala takto:
        TAATTAGCTACGGCGCTACGGCGCTACGTAGCTACGGCATTACGTATAATCGATAT
TAATCGTATACGGCCGTACGATGCATCGGCCGATATCGCGATGCATTAATGCTACG
ATGCATATATGCATATATCGATATTAATATTATACGGCTATAGCATATTACGCGAT
TACGCGTATAGCTAATTACGCGATTACGTATATACGATTATAGCTAATTAGCATCG
TACGTATAATCGATATTATAATATTACGATTATAGCATCGTACGCGGCTAGCTAGC
TACGATTATAGCCGTAATATCGCGTAATGCTATACGGCGCTAGCTATATACGGCCG
TAGCTAATTACGATTATACGCGTATACGGCCGATCGATATTATATACGTACGCGTA
TACGTATATAGCTAGCATCGATATTAATATGCTAATATTAATCGATATATGCCGTA
ATGCTAATATGCATATATGCTAATATGCATGCATATCGCGTAGCATATTACGCGAT
TACGGCGCTACGGCCGTACGTATAATGCCGCGATCGATATATCGCGATATGCTACG
ATGCTATAATGCATATATCGCGTAATCGATATATGCATCGATGCTATAATGCATGC
ATCGGCTAATGCATATATGCATATATGCATATATGCATATATATCGCGTACGTACG
TACGATTATAGCCGATATGCCGCGATCGATATATCGCGATATGCTACGATGCTATA
ATGCATATATCGCGTAATCGATATATGCATCGATGCTATAATGCATGCATCGGCTA
ATGCATATATGCATATATGCATATATGCATTA

Šlo by to nádherně překreslit do molekuly DNA do 3D modelu, ale to by tomu již přineslo jen fyzickou podstatu.
Proto, aby jste s touto informací mohli pracovat musíte vědět jak ji interpretovat. Copak o to, já to vím, ale jak na to přijít když nevíte nic víc než ten řádek výše? Kolikatibitové kódování jsem použil? Jaké kódování? ASCII? EBDIC? Kolik vůbec písmen může mít moje abeceda? ISO-LATIN-2 nebo Windows-1250? Představte si jak by toto asi rozkódovával mimozemšťan, který o nás netuší vůbec nic.

A to vůbec nemluvím o nebezpečích, která z takových objevů plynou. Představte si budoucí inženýry hledající lék na nový typ chřipky když tu v jeho kódu objeví shakespeareho verše.

Jurský park by Google

V známém Spielbergově filmu se dinosauři rodili z genetické informace získané z krve dinosaurů obsažené v komárech, kteří uvázli v prehistorické pryskyřici - jantaru. Bohužel DNA není schopna přežít miliony let, ale přesto tato idea není zcela mimo.

Proto, aby vznikl nějaký organismus je třeba minimálně celé jeho genetické informace. Zní to logicky, ale není to úplně pravda. Velká část genetické informace je "hluchá", v tom lepším případě jen absolutně nevíme k čemu by mohla sloužit.

Podívali jste se někdy do toho co všechno je v takovém DOC souboru od MS Office po té co projde firmou tak po půl roce? Spousta z těch informací již k ničemu není a ani není cesta jak by se k nim samotný Word dostal. Alespoň ne na uživatelské úrovni.

Obdobně je to s genofondem. Spousty úseků jsou zbytky pradávných informací, které již k ničemu neslouží, bylo by možné zde najít kusy cizích genetických informací, úseků pocházejících z virů a kdo ví odkud.

Tedy všemu možná ani není třeba rozumět, ale co když máme genetické informace, které jsou neúplné? Můžeme je doplnit jen na základě genetického inženýrství? Obdobně jako v Jurském parku? Ano, pokud jsem se doteď pohyboval ve vzdálené budoucnosti, vítejte v současnosti.
V roce 2005 byl ohlášená kompletace genetického kódu jeskynního medvěda vycházející ze vzorků zubů z lokalit v Rakousku. Stáří vzorků bylo odhadnuto na asi 400 000 let. Jeskyní medvěd vymřel před 100 000 roky.
Paradoxně největším problémem nebyl nedostatek genetické informace, ale její přebytek - znečištění genetickou informací, zejména pak bakteriální. To jsou ale přesně místa kde mohou pomoci technologie, které rozvíjí Google. Identifikace podstatných sekvencí a eliminace těch přebytečných.

I když hodně informací chybělo, ukázalo se, že to není až takový problém. Jeskyní medvěd totiž má totiž 92 procent genetické informace shodné se psem s nímž sdílí společné předky. Pro představu člověk a šimpanz sdílí dokonce 99% genetické informace.

Porozumět tomu všemu ale znamená umět pracovat s informací a to umí … Google. Samozřejmě nejen, ale on sám je jedním z mála kdo s tím má zkušenosti ve větším rozsahu a jehož technologie by výzkumu v této oblasti mohly pomoc.

Tak se mi zdá, že pomalu vstupujeme do trochu jiného světa. Autoři výzkůmů jeskynního medvěda doufají, že jejich práce pomůže sekvencování DNA neandrtálců a hobitů z ostrova Flores v Indonesii- Homo floresiensis, který vyhynul zřejmě před 11 až 18 000 lety.

Šílené? Ne, teprve začátek ….

Pokus o vtip: nějak tak by měl vypadat Mars po terraformingu
V případě, že se nám podaří rozluštit genetickou informaci a nezničit při tom sami sebe, otevřely by se lidstvu obrovské možnosti, které lze využít v jeho prospěch, stejně jako neprospěch. Oživení vyhynulých zvířat je jen jedna z mnoha věcí. Na základě poznání genetického kódu by bylo možné vytvářet i mystické organismy, které nikdy nežily.

Např. vyprojektovat úpíra nebo sfingu by byla otázka projektová a nikoliv mytologie. Otázek co by ještě mohlo jít je mnoho. I když to vše připomíná genesis, není to nic proti otázkám jako co by znamenalo rozšíření počtu bází v DNA o další dvě. Mimo jiné by to znamenalo kompletní biochemické změny takového organizmu způsobem, který si asi nikdo neumí ani představit. A mělo by to nějaký smysl?

Řízená genesis by ale smysl měla a možná ji jednou budeme potřebovat při terraforming - přetváření planet do podoby Země. Pokud budeme chtít žít na Marsu nebo Venuši, bude třeba udělat obrovské pokroky i v této oblasti. Třeba jednou dopadnou na povrch rudé planety tisíce malých kapslí s nápisem Google - NASA s organismy, které budou mít 50 až 100 let na to, aby zajistila kompletní proměnu planety od úpravy atmosféry, oběhu vody až po vytvoření kompletního ekosystému. Jak říkám - Genesis.

Ale o tom snad zase někdy jindy.
Ps. A berte teno článek s trochou nadsázky ...
 

Buď první, kdo ohodnotí tento článek.

Komentáře

1 whitwa whitwa | E-mail | Web | 27. listopadu 2005 v 15:27 | Reagovat

Toto hraní na boha stejně tak jako snaha o A.I., likvidace země a naše zvrácenost bude jendou naším nevyhnutelným koncem.

2 Petr Šnajdr Petr Šnajdr | 27. listopadu 2005 v 15:35 | Reagovat

Taky se obávám, ale stejnějako u AI tomu i u genetického inženýrství nejde zabránit. I kdyby se všichni dohodli, že vývoj v tomto směru nebude pokračovat, určitě se najde někdo kdo v tom bude vidět možnost vojenské převahy.

Další věc je, že růst složitosti naší civilizace si takové technologie bude žádat. Obávám se, že terraforming bez genetiky je skoro nemožný  a nebo neúnosně zdlouhavý.

Stejně jako u AI je u genetiky nebezpečná zejména ta schopnost sebereplikace a "převládnutí".

Na druhou stranu tohle může být i obrana proti tomu ...

3 whitwa whitwa | E-mail | Web | 27. listopadu 2005 v 15:43 | Reagovat

AI bude náš největši a zároveň polsední vynález - vem te si, že člověk je něco neprosto nedokonalého, je snano manipulovatelný, potřebuje jíst, pít, dýcha, určitou teplotu, společnost, životní cíle, má city, atd... narozdíl od toho robot s AI - to ani nemusím komentovat. Je to neodvratitelná další forma života, která se vyvine vlastně z nás, nic biologického a křehkého, pouze chladně myslící mechanický stroj, který se vyvíjí daleko rychleji než cokoliv co jsme kdy vyděli. Bude nás takovýto stroj ještě potřebovat? Proč? K čemu? Leda ke zkoumání...

4 Petr Šnajdr Petr Šnajdr | 27. listopadu 2005 v 15:49 | Reagovat

Konečně:

http://management.blog.cz/0511/technologicka-singularita

5 jilm jilm | E-mail | Web | 27. listopadu 2005 v 16:21 | Reagovat

Třeba ne. Třeba se jen přizpůsobíme, resp. se stroji splyneme.

6 Petr Šnajdr Petr Šnajdr | 27. listopadu 2005 v 16:38 | Reagovat

Ještě chci dodat, že i když tento text by se  měl zejména míésty číst se značnou dávkou nadsázky jsou aktivity zakladatelů Google v některých oblastech, které budou v budoucnu zřejmě hrát významnou roli, poměrně dobře vystopovatelné.

Např. kromě spolupráce s NASA, zmíňěného genetického inženýrství je v boardu X-PRIZE Foundation, která se snaží popořit soukromý výzkum v oblasti letů do vesmíru apod.

7 whitwa whitwa | E-mail | Web | 27. listopadu 2005 v 16:41 | Reagovat

[6] :)) Takže první vyhledávač ve vesmíru bude google :)

8 Petr Šnajdr Petr Šnajdr | 27. listopadu 2005 v 16:41 | Reagovat

Chtěl jsem napsat, že v boardu X-Prize Foundadtion je LArry PAge z Google, ale úplně mi to t roho textu vypadlo.

9 Petr Šnajdr Petr Šnajdr | 27. listopadu 2005 v 16:49 | Reagovat

[7] To zase ne. Specializovaných vyhledávačů ve vesmíru je vlastně už docela hodně. Třeba Hubbleův teleskop a na druhé straně špionážní družice jsou typické specializované vyhledávače :-)

10 whitwa whitwa | E-mail | Web | 27. listopadu 2005 v 17:17 | Reagovat

Ted me tak napada - dopravit flusanec az za obeznou drahu, krom toho ze by to byl prvni "kemr" ve vesmiru, by mohl dorazit na nejakou vzdalenou planetu a vytvorit zivot. Sci-fi ze? Je to stejne sci-fi, jako rikat, ze se neco z toho, o cem se tu bavime, nestane ;).

11 Michal Kára Michal Kára | 27. listopadu 2005 v 18:20 | Reagovat

S tim AI bych to nevidel zdaleka tak hrozne :-)

12 Petr Šnajdr Petr Šnajdr | 27. listopadu 2005 v 18:54 | Reagovat

[10] Na to se dá odpovědět pouze citací ze Stopařova průvodce po galaxii:

Neopatrné výroky mohou přijít draho, a dokonce způsobit i ztráty na životech. To je známá věc. Málokdy je však závažnost problému chápána v plném rozsahu.

Například právě v okamžiku, kdy Arthur vyslovil: „Zato můj životní styl je dost namáhavý“, vyskytla se v předivu časoprostorového kontinua porucha v podobě nepatrné dírky, kterou jeho slova pronikla daleko zpátky v čase, přes téměř nekonečné rozlohy prostoru, až do daleké galaxie, jejíž obyvatelé, podivné bojechtivé bytosti, právě balancovali na pokraji mezihvězdné bitvy.

Vůdci znepřátelených stran naposledy vyjednávali.

Konferenční stůl halilo děsivé ticho. Velitel Vl'hurgů v nádherném bitevním úboru - červených trenýrkách pošitých drahokamy, zíral kamenným pohledem na vůdce G'Gugvinttů, dřepícího naproti v oblaku zelených sladce páchnoucích výparů. Milión lesklých, po zuby ozbrojených hvězdných křižníků čekalo na jediné slovo, aby začaly chrlit elektrickou smrt. Velitel Vl'hurgů právě vyzval podlou stvůru naproti sobě, aby odvolala, co řekla o jeho mamince.

Stvůra se zavrtěla v oblaku svého hnusného, žhoucího odéru, když vtom nad konferenčním stolem proplula slova Zato můj životní styl je dost namáhavý.

Naneštěstí je to ve vl'hurgském jazyce nejhorší urážka, jaké se kdo může dopustit, na niž není jiná odpověď, než strašlivá, staletí trvající válka.

Až po několika tisících let, během nichž stačily zcela zdecimovat svou vlastní galaxii, pochopily obě strany, že celá záležitost byla jen tragický omyl. A tak vyřešily zbývající drobné názorové rozdíly, aby mohly spojit síly v útoku na naši Galaxii, v které teď neomylně rozpoznaly viníka - původce oné urážlivé poznámky.

A po další tisíce let se mocné lodi řítily kosmickou pustinou, až se nakonec s jekotem vrhly na první planetu, která jim padla do cesty - shodou okolností to byla právě Země -, kde však v důsledku chybného odhadu měřítka došlo k tragické nehodě. Celé bitevní loďstvo sežral malý psík.

Badatelé, zabývající se dopodrobna složitým působením příčiny a následku v dějinách vesmíru, tvrdí, že takovéhle věci se dějí v jednom kuse, jenomže jsme proti nim bezmocní. Nejsou s to říct k tomu víc než: „To je prostě život“.

13 Michal Horák Michal Horák | Web | 27. listopadu 2005 v 19:34 | Reagovat

Ta AI nebude zase tak hrozna, lide si vzdy nechavaji zadni vratka a tak by se podle me nemelo stat, ze by nas roboti predcili.

Ze se google zacne venovat genetickemu inzenyrstvi je podle me dobre, jsou v tom opravdu velke moznosti a google ma ten potencial. Jen je potreba pracovat s rozumem. Nevidel bych to na zadny katastroficky scenar

14 Petr Šnajdr Petr Šnajdr | 27. listopadu 2005 v 23:09 | Reagovat

S. mě upozornila, že v bázích mám chybu a že jsem zapoměl na Uracil.

No... jo, zapoměl. Báze opravdu nejsou 4, ale je jich 5. Tou pátou je Uracil.

Nicméně!

Uracil je pyrimidinová báze, která tvoří pár s adeninem a vyskytuje se v RNA namísto Thyminu

Tedy to nic nemění na tom co jsem napsal :-) (alepoň ne v tom zjednodušení, které jsem použil)

15 Jakub Vrána Jakub Vrána | Web | 28. listopadu 2005 v 9:48 | Reagovat

Moc pěkný článek, jenom jedna technická - pokud jsou možné 4 hodnoty, tak je to kódování 2bitové, nikoliv 4bitové.

16 Vita Vita | E-mail | Web | 29. prosince 2005 v 19:51 | Reagovat

Terestrizace má budoucnost. Hurá...

17 Petr Žampach Petr Žampach | E-mail | 29. prosince 2007 v 19:35 | Reagovat

Já myslím že to kraviny nejsou.Amyslím si že když neůplné DNA dinosaura doplníme žabím tak nám vznikne kompletní DNA a s toho by NÁM nějaká matlanice mohla vzniknout. Já se o dinosauri zajímám už 8 let.

18 Ondra Ondra | 3. srpna 2008 v 15:49 | Reagovat

Až vytvoříme samostatnou AI, určitě to nebude robot na bázi křemíkových čipů. Bude to nejspíš nějaká kopie mozku. Náš mozek je totiž dobře vyvážený - všeobecnost, rychlost, spolehlivost a spotřeba energie.

Můj odhad první samostatné uměle vytvořené myslící bytosti (klonování nepočítaje) je kolem roku 2055.

Otázka je, co ten, kdo získá např. lék na HIV, s daným know-how udělá. Nejspíš na něm vydělá pohádkové jmění, ale o tendencích vlastnit planetu pochybuji - neboť pokud vlastníci té společnosti doufejme nebudou nějací psychopati, jistě si uvědomí, že je lepší mít menší podíl na bohatství prosperující planety než většinový podíl na planetě zmítané virem HIV / válkami / chudobou...

19 DK DK | 20. srpna 2009 v 10:59 | Reagovat

jo aha takže až tady bude běhat t-rex a na hřbetu bude mít vypálený Made By Google tak se ani nikdo divit nebude jak si to tu čtu :D

20 TalleyDaphne19 TalleyDaphne19 | E-mail | Web | 7. listopadu 2011 v 12:45 | Reagovat

Different people in every country take the <a href="http://goodfinance-blog.com/topics/mortgage-loans">mortgage loans</a> in various creditors, just because that's simple and comfortable.

21 Jake Landall Jake Landall | E-mail | Web | 3. dubna 2012 v 13:08 | Reagovat

Nezaplacení obsah obsažené v obsahu tohoto příspěvku. Jsem upřímně nečekal odvodit co nejvíce cenných informací, jako to, co bylo zjeveno tady, takže mě zajímalo, co jiného je otevřený pro objev na tomto webu.

22 Angela Angela | E-mail | 23. února 2015 v 4:04 | Reagovat

Je tu mnoho pochybností o vyléčení hiv AIDS, také byl měl pochybnosti, ale teď mám věřit, že zázrak jsem obdržel může být také přínosem pro svět. Mé jméno je Angela, můj email je angelafreemane@ gmail. com jsem žil s touto nevyléčitelnou chorobu za více než rok, můj manžel zjistil, že jsme byli oba HIV pozitivní. Všemi prostředky se snažíme žít svůj život i přes to, co v našem těle je, jen když jsme narazili na tento mocný bylinkáře, který ztvárnil lék. Na začátku, jsme byli více skeptičtí, ale můj manžel trval na dávat to zkusit a jsme objednali pro některé z jeho byliny a pár týdnů po dokončení procesu kvůli tomuto bylinkář, šli jsme na zkoušku jak jsme také řekl, jsme byli zavaleni štěstí, když jsem obdržel výsledky v klinice. Míra virus v těle a klesl za pár týdnů, co jsme byli úplně uzdravil. Také jsme se zeptali, proč nepřišel na svět měl lék a on řekl, že v roce 2011, ale byl odmítnut mezinárodní výzkumný tým. Nejdůležitější je pro vás uzdraví Pokud chcete vědět o tomto bylinkář volání na +2349032913215 nebo e-mail: odincurahiv@ gmail. com nebo odincurahiv@ outlook. com

23 Visit On This Link Visit On This Link | E-mail | Web | 20. července 2016 v 12:22 | Reagovat

It is a great website.. The Design looks very good.. Keep working like that!.

24 Water-drop Hook Water-drop Hook | E-mail | Web | 15. srpna 2017 v 13:58 | Reagovat

It has been quite an adventure, and i can say that finding this post was rather helpful. This is among the posts that i have found to be highly informative and fascinating.

Nový komentář

Přihlásit se
  Ještě nemáte vlastní web? Můžete si jej zdarma založit na Blog.cz.
 

Aktuální články

Reklama